TGFBR2 cDNA ORF Clone, Rat, N-HA tag

Price:
Size:
Number:

TGFBR2 cDNA ORF Clone, Rat, N-HA tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1704 bp
Description
Full length Clone DNA of Rat transforming growth factor, beta receptor II with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TGFBR2 Background Information

TGFBR2 is member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. It is a transmembrane protein. TGFBR2 is comprised by a C-terminal protein kinase domain and an N-terminal ectodomain. The ectodomain consists of a compact fold containing nine beta-strands and a single helix stabilised by a network of six intra strand disulphide bonds. The folding topology includes a central five-stranded antiparallel beta-sheet, eight-residues long at its centre, covered by a second layer consisting of two segments of two-stranded antiparallel beta-sheets. TGFBR2 has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in TGFBR2 gene have been associated with Marfan syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. TGFBR2 attenuates the biological activities of TGF-beta in colorectal cancer. TGFBR2 expression is increased in oral squamous cell carcinoma cells. Its expression is decreased by IL-1beta while inducing Sp3 via NFkappaB. TGFB2 and TGFBR2 are involved in the antiestrogenic activity.
Full Name
transforming growth factor, beta receptor II (70/80kDa)
References
  • Yu Y, et al. (2012) MicroRNA-21 induces stemness by downregulating transforming growth factor beta receptor 2 (TGFβR2) in colon cancer cells. Carcinogenesis. 33(1):68-76.
  • Shima K, et al. (2011) TGFBR2 and BAX mononucleotide tract mutations, microsatellite instability, and prognosis in 1072 colorectal cancers. PLoS One. 6(9):e25062.
  • Biros E, et al. (2011) Meta-analysis of the association between single nucleotide polymorphisms in TGF-β receptor genes and abdominal aortic aneurysm. Atherosclerosis. 219(1):218-23.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait