Pedido rápido

Rat TNFRSF12A/FN14/TWEAKR clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat TNFRSF12A Información de producto de clon de cDNA
Tamaño de cDNA:390bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus tumor necrosis factor receptor superfamily, member 12a with N terminal Flag tag.
Sinónimo de gen:Fn14, MGC72653, Tnfrsf12a
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rat TNFRSF12A/FN14/TWEAKR clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Product nameProduct name

Fn14 (tumor necrosis factor receptor superfamily, member 12A), also known as TNFRSF12A, is the receptor for TNFSF12/TWEAK. Fn14 shares 82% amino acid identity with the mouse sequence. It contains a signal peptide, an extracellular domain, a membrane-anchoring domain, and a cytoplasmic domain. In response to FGF1, calf serum, or phorbol ester stimulation of human quiescent fibroblasts in vitro, the level of Fn14 is increased. A 1.2-kb FN14 transcript was expressed at high levels in heart, placenta, and kidney, at intermediate levels in lung, skeletal muscle, and pancreas, and at low levels in brain and liver. In addition, elevated FN14 expression was found in human liver cancer cell lines and hepatocellular carcinoma specimens. Expression of mouse Fn14 was upregulated in hepatocellular carcinoma nodules that develop in 2 different transgenic mouse models of hepatocarcinogenesis. TNFRSF12A is the weak inducer of apoptosis in some cell types. It promotes angiogenesis and the proliferation of endothelial cells. TNFRSF12A may modulate cellular adhesion to matrix proteins.

  • Burkly LC, et al. (2011) The TWEAK/Fn14 pathway in tissue remodeling: for better or for worse. Adv Exp Med Biol. 691:305-22.
  • Huang M, et al. (2011) Overexpression of Fn14 promotes androgen-independent prostate cancer progression through MMP-9 and correlates with poor treatment outcome. Carcinogenesis. 32(11):1589-96.
  • Dharmapatni AA, et al. (2011) TWEAK and Fn14 expression in the pathogenesis of joint inflammation and bone erosion in rheumatoid arthritis. Arthritis Res Ther. 13(2):R51.
  • Size / Price
    Catálogo: RG80164-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.