TNFRSF1A cDNA ORF Clone, Rat, N-His tag

Price:
Size:
Number:

TNFRSF1A cDNA ORF Clone, Rat, N-His tag: General Information

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1386 bp
Description
Full length Clone DNA of Rat tumor necrosis factor receptor superfamily, member 1a with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

TNFRSF1A Background Information

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 32 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD12a (cluste of differentiation 12a), also known as TNFR1 / TNFRSF1A, is a member of CD family, tumor necrosis factor receptor superfamily. CD12a is one of the most primary receptors for the tumor necrosis factor-alpha. It has been shown to be localized to both plasma membrane lipid rafts and the trans golgi complex with the help of the death domain (DD). CD12a can activate the transcription factor NF-κB, mediate apoptosis, and regulate inflammation processes.
Full Name
tumor necrosis factor receptor superfamily member 1A
Research Areas
References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Cottin V, et al. (2002) Restricted localization of the TNF receptor CD120a to lipid rafts: a novel role for the death domain. The journal of immunology. 168: 4095-102.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait