Pedido rápido

Text Size:AAA

Rat TSPAN31 clonación del ADN o clonación génica(vector de clonación), C-Myc Etiqueta

    Hoja de datosReseñasProductos relacionadosProtocolos
    Rata TSPAN31 Información de producto de clon de cDNA
    Tamaño de cDNA:633bp
    Descripción de cDNA:Full length Clone DNA of Rattus norvegicus tetraspanin 31 with C terminal Myc tag.
    Sinónimo de gen:Sas
    Sitio de restricción:
    Secuencia de etiquetas:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descripción de la secuencia:
    ( We provide with TSPAN31 qPCR primers for gene expression analysis, RP301067 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name

    TSPAN31 is a member of the transmembrane 4 superfamily. Most members of this family are cell-surface proteins that are characterized by the presence of four hydrophobic domains. They mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. TSPAN31 is thought to be involved in growth-related cellular processes. This gene is associated with tumorigenesis and osteosarcoma.

  • Wright MD. et al., 1995, Immunol Today. 15 (12): 588-94.
  • Meltzer PS. et al., 1992, Cell Growth Differ. 2 (10): 495-501.
  • Jankowski SA. et al., 1995, Genomics. 25 (2): 501-6.
  • Size / Price
    Catálogo: RG81110-CM
    Precio de lista: 
    Precio:      (You Save: )
    Añadir a carroBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.