After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Pedido rápido

Text Size:AAA

Rat TXN2 ORF mammalian expression plasmid, C-Flag tag

Hoja de datosReseñasProductos relacionadosProtocolos
Rat TXN2 Información de producto de clon de cDNA
Tamaño de cDNA:501bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus thioredoxin 2 with C terminal Flag tag.
Sinónimo de gen:Txn2
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Thioredoxin-2, also known as TXN2, MTRX and TRX2, is a member of the thioredoxin family. Tryparedoxins (TXN) are thioredoxin-related proteins which, as trypanothione:peroxiredoxin oxidoreductases, constitute the trypanothione-dependent antioxidant defense and may also serve as substrates for ribonucleotide reductase in trypanosomatids. Thioredoxin-2 / TXN2 contains one thioredoxin domain. It is widely expressed in adult (at protein level) and fetal tissues. Human Thioredoxin-2 / TXN2 is a small redox protein important in cellular antioxidant defenses, as well as in the regulation of apoptosis. Thioredoxin-2 / TXN2 has an anti-apoptotic function and plays an important role in the regulation of mitochondrial membrane potential. Thioredoxin-2 / TXN2 could be involved in the resistance to anti-tumor agents. It possesses a dithiol-reducing activity. Thioredoxin-2 / TXN2 plays an important role in protecting the mitochondria against oxidative stress and in sensitizing the cells to ROS-induced apoptosis. Mammalian Thioredoxin-2 / TXN2 is a mitochondrial isoform of highly evolutionary conserved thioredoxins. Thioredoxins are small ubiquitous protein-disulfide oxidoreductases implicated in a large variety of biological functions.

  • Chen Y., et al., 2002, J. Biol. Chem. 277: 33242-8.
  • Smeets A., et al., 2005, Protein Sci. 14: 2610-21.
  • Wen,S. et al., 2009, Am J Med Genet A  149A (2): 155-60.
  • Choudhary C., et al., 2009, Science 325: 834-40.
  • Size / Price
    Catálogo: RG81095-CF
    Precio de lista:   (Save )
    Precio:      [How to order]
     Instrucciones de envío
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.