Pedido rápido

Text Size:AAA

Rat VRK1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta

Hoja de datosReseñasProductos relacionadosProtocolos
Rat VRK1 Información de producto de clon de cDNA
Tamaño de cDNA:1245bp
Descripción de cDNA:Full length Clone DNA of Rattus norvegicus vaccinia related kinase 1 with N terminal Flag tag.
Sinónimo de gen:Vrk1
Sitio de restricción:
Secuencia de etiquetas:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descripción de la secuencia:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Rat VRK1 clonación del ADN o clonación génica(vector de clonación), N-Flag Etiqueta on other vectors
Product nameProduct name

VRK1 is a member of the vaccinia-related kinase (VRK) family of serine/threonine protein kinases. Serine/threonine protein kinases are tumor suppressor that controls the activity of AMP-activated protein kinase family members, thereby playing a role in various processes such as cell metabolism, cell polarity, apoptosis and DNA damage response. VRK1 contains 1 protein kinase domain and localizes to the nucleus. VRK1 gene is widely expressed in human tissues and has increased expression in actively dividing cells, such as those in testis, thymus, fetal liver, and carcinomas. As a serine/threonine kinase, VRK1 phosphorylates 'Thr-18' of p53/TP53 and may thereby prevent the interaction between p53/TP53 and MDM2. Defects in VRK1 are the cause of pontocerebellar hypoplasia type 1 (PCH1), also called pontocerebellar hypoplasia with infantile spinal muscular atrophy or pontocerebellar hypoplasia with anterior horn cell disease. PCH1 is characterized by an abnormally small cerebellum and brainstem, central and peripheral motor dysfunction from birth, gliosis and anterior horn cell degeneration resembling infantile spinal muscular atrophy.

  • Sugimoto J, et al. (1999) Isolation and mapping of a polymorphic CA repeat sequence at the human VRK1 locus. J Hum Genet. 44 (2): 133-4.
  • Lopez-Borges S, et al. (2000) The human vaccinia-related kinase 1 (VRK1) phosphorylates threonine-18 within the mdm-2 binding site of the p53 tumour suppressor protein. Oncogene. 19 (32): 3656-64.
  • Sevilla A, et al. (2004) c-Jun phosphorylation by the human vaccinia-related kinase 1 (VRK1) and its cooperation with the N-terminal kinase of c-Jun (JNK). Oncogene. 23 (55): 8950-8.
  • Size / Price
    Catálogo: RG81611-NF
    Precio de lista: 
    Precio:      (You Save: )
    Disponibilidad2-3 weeks
    Bulk Discount RequiryAñadir a carro
    Contact Us
        Artículos vistos recientemente
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.