Pedido rápido

Hoja de datosReseñasProductos relacionadosProtocolos
Humano SERPINA4 Información de producto de clon de cDNA
Gene_bank_ref_id:
Tamaño de cDNA:
Descripción de cDNA:
Sinónimo de gen:
Especie:
Vector:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:
Shipping_carrier:
Almacenamiento:
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"