Pedido rápido

Text Size:AAA

Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Mouse VEGF-C Información de producto de clon de cDNA
Tamaño de cDNA:
Descripción de cDNA:
Sinónimo de gen:
Sitio de restricción:
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref.ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Mouse VEGF-C Gene Plasmid Map
Mouse VEGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaMG50391-ACG$225
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaMG50391-ACR$225
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaMG50391-CF$195
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50391-CH$195
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaMG50391-CM$195
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaMG50391-CY$195
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(Vector de expresión)MG50391-M$75
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaMG50391-M-H$195
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaMG50391-NF$195
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaMG50391-NH$195
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaMG50391-NM$195
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaMG50391-NY$195
Ratón VEGFC/VEGF-C/Flt4-L clonación del ADN o clonación génica(vector de clonación)MG50391-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name

Vascular endothelial growth factor C (VEGF-C) is a member of the VEGF family. Upon biosynthesis, VEGF-C protein is secreted as a non-covalent momodimer in an anti-parellel fashion. VEGF-C protein is a dimeric glycoprotein, as a ligand for two receptors, VEGFR-3 (Flt4), and VEGFR-2. VEGF-C may function in angiogenesis of the venous and lymphatic vascular systems during embryogenesis. VEGF-C protein is over-expressed in various human cancers including breast cancer and prostate cancer. VEGF-C/VEGFR-3 axis, through different signaling pathways, plays a critical role in cancer progression by regulating different cellular functions, such as invasion, proliferation, and resistance to chemotherapy. Thus, targeting the VEGF-C/VEGFR-3 axis may be therapeutically significant for certain types of tumors.

  • Joukov V, et al. (1997) Vascular endothelial growth factors VEGF-B and VEGF-C. J Cell Physiol. 173(2): 211-5.
  • Su JL, et al. (2007) The role of the VEGF-C/VEGFR-3 axis in cancer progression. Br J Cancer. 96(4): 541-5.
  • Anisimov A, et al. (2009) Activated forms of VEGF-C and VEGF-D provide improved vascular function in skeletal muscle. Circ Res. 104(11): 1302-12.
  • Contact Us
    • Mouse VEGF-C Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.