West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, C-His tag

Price:
Size:
Number:

West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 ORF mammalian expression plasmid, C-His tag: General Information

Gene
Species
WNV
NCBI Ref Seq
RefSeq ORF Size
1056 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence DQ211652.1 (2470..3525), corresponding to amino acid sequence YP_001527881.1.
Description
Full length Clone DNA of West Nile Virus (WNV) (lineage 1, strain NY99, Isolate 385-99) NS1 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

WNV Nonstructural protein 1 Background Information

Full Name
interferon regulatory factor 3

WNV Nonstructural protein 1 cDNA ORF Clone, WNV, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait