Pedido rápido

Text Size:AAA

Canine CMPK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CMPK1cDNA Clone Product Information
Gene Bank Ref.ID:XM_847756.4
cDNA Size:687
cDNA Description:ORF Clone of Canis lupus familiaris cytidine monophosphate (UMP-CMP) kinase 1, cytosolic DNA.
Gene Synonym:CMPK
Species:Canine
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

CMPK1 plays a key role in the maintenance of pyrimidine nucleotide pool profile and for the metabolism of pyrimidine analogs in cells. It catalyzes the phosphoryl transfer from ATP to UMP, CMP, and deoxy-CMP (dCMP), resulting in the formation of ADP and the corresponding nucleoside diphosphate. CMPK1 also has a significant role in the activation of pyrimidine analogs, which are clinically useful anti-cancer and anti-viral drugs. In the meanwhile, CMPK1 functions in cellular nucleic acid biosynthesis.

References
  • Liou J, et al. (2004) Phosphorylation of Cytidine, Deoxycytidine, and Their Analog Monophosphates by Human UMP/CMP Kinase is Differentially Regulated by ATP and Magnesium. Molecular Pharmacology. 67(3):806-14.
  • Gerhard DS, et al. (2004) The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC). Genome Research. 14(10B):2121-7.
  • Segura-Pena D, et al. (2004) Substrate-induced Conformational Changes in Human UMP/CMP Kinase. Journal of Biological Chemistry. 279(32):33882-9.
  • Catalog:DG70228-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"