Pedido rápido

Human EphB2 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
EPHB2cDNA Clone Product Information
Gene Bank Ref.ID:NM_004442.6
cDNA Size:2964
cDNA Description:ORF Clone of Homo sapiens EPH receptor B2 DNA.
Gene Synonym:DRT, ERK, CAPB, Hek5, PCBC, EPHT3, Tyro5, MGC87492, EPHB2
Species:Human
Vector:pCMV3-N-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
 
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ephrin & Eph Receptor Related Products
Product nameProduct name
Human EphA1 / Eph Receptor A1 Protein (His Tag, ECD)Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Mouse Ephrin B3 / EFNB3 Protein (His Tag)Mouse EphB6 Protein (His Tag)Mouse Ephrin B3 / EFNB3 Protein (ECD, Fc Tag)Human Ephrin-A4 / EFNA4 Protein (Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK ProteinHuman EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 ProteinHuman Ephrin-A3 / EFNA3 ProteinHuman Ephrin-A3 / EFNA3 Protein (His & Fc Tag)Human Ephrin-A5 / EFNA5 Protein (Fc Tag)Human Ephrin-A1 / EFNA1 Protein (His & Fc Tag)Human Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB2 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His Tag)Human Ephrin-A1 / EFNA1 Protein (His Tag)Human Ephrin-B1 / EFNB1 Protein (His & Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His & Fc Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Human Ephrin-A3 / EFNA3 / EFL2 Protein (Fc Tag)Human Ephrin-A3 / EFNA3 Protein (His Tag)Human EphB6 / EphB6 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (His Tag)Mouse Ephrin-B2 / EFNB2 Protein (Fc Tag)Human Ephrin-B2 / EFNB2 Protein (His Tag)Human EphA4 Protein (His Tag)Human EphA7 / EHK3 Protein (His Tag)Mouse Ephrin-A1 / EFNA1 Protein (Fc Tag)Mouse Ephrin-A1 / EFNA1 Protein (His Tag)Mouse Ephrin-A3 / EFNA3 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (His Tag)Mouse Ephrin-A4 / EFNA4 Protein (Fc Tag)Mouse Ephrin-A5 / EFNA5 Protein (His Tag)Mouse Ephrin-A5 / EFNA5 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (Fc Tag)Mouse Ephrin-B1 / EFNB1 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 Protein (His Tag)Mouse EphA2 Protein (His Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse Ephrin-A2 / EFNA2 ProteinHuman EphB1 / EPHT2 Protein (His Tag)Human EphA4 Protein (His & Fc Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse EphA1 / EPH receptor A1 Protein (His Tag)Rat Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-A5 / EFNA5 Protein (His Tag)Rat Ephrin-B1 / EFNB1 Protein (His Tag)Rat Ephrin-B2 / EFNB2 Protein (Fc Tag)Cynomolgus Ephrin-A5 / EFNA5 Protein (Fc Tag)Rat Ephrin-B2 / EFNB2 Protein (His Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Rat Ephrin-B1 / EFNB1 Protein (Fc Tag)Rat Ephrin-A1 / EFNA1 Protein (His Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Rat EphA4 Protein (His Tag)Cynomolgus EphA4 Protein (Fc Tag)Rat EphA4 Protein (Fc Tag) Cynomolgus Ephrin-A5 / EFNA5 Protein (His Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Human EphA2 Protein (aa 585-976, His & GST Tag)Rat Ephrin-B3 / EFNB3 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Rat Ephrin-B3 / EFNB3 Protein (Fc Tag)Cynomolgus EphA4 Protein (His Tag)Human EphB2 / Hek5 ProteinRat EphA7 / EHK3 Protein (His Tag)Human EphA2 Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (Fc Tag)Danio rerio (zebrafish) EFNB2A / Ephrin B2a Protein (His Tag)Canine Ephrin-A5 / EFNA5 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (His Tag)Human Ephrin-B2 / EFNB2 ProteinCynomolgus EphB1 / EPHT2 Protein (Fc Tag)Canine Ephrin-B2 / EFNB2 Protein (Fc Tag)Cynomolgus EphB1 / EPHT2 Protein (His Tag)Mouse EphB2 / Hek5 Protein (His Tag)
Background

Ephrin type-B receptor 2, also known as EphB2, belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family which 16 known receptors (14 found in mammals) are involved: EPHA1, EPHA2, EPHA3, EPHA4, EPHA5, EPHA6, EPHA7, EPHA8, EPHA9, EPHA10, EPHB1, EPHB2, EPHB3, EPHB4, EPHB5, EPHB6. EphB2 receptor tyrosine kinase phosphorylates syndecan-2 and that this phosphorylation event is crucial for syndecan-2 clustering and spine formation. The Eph family of receptor tyrosine kinases (comprising EphA and EphB receptors) has been implicated in synapse formation and the regulation of synaptic function and plasticity6. Ephrin receptors are components of cell signalling pathways involved in animal growth and development, forming the largest sub-family of receptor tyrosine kinases (RTKs). Ligand-mediated activation of Ephs induce various important downstream effects and Eph receptors have been studied for their potential roles in the development of cancer. EphB receptor tyrosine kinases are enriched at synapses, suggesting that these receptors play a role in synapse formation or function. We find that EphrinB binding to EphB induces a direct interaction of EphB with NMDA-type glutamate receptors. This interaction occurs at the cell surface and is mediated by the extracellular regions of the two receptors, but does not require the kinase activity of EphB.

References
  • Zisch AH, et al. (1998) Complex formation between EphB2 and Src requires phosphorylation of tyrosine 611 in the EphB2 juxtamembrane region. Oncogene. 16 (20): 2657-70.
  • Yu HH, et al. (2001) Multiple signaling interactions of Abl and Arg kinases with the EphB2 receptor. Oncogene. 20 (30): 3995-4006.
  • Zisch AH, et al. (2000) Replacing two conserved tyrosines of the EphB2 receptor with glutamic acid prevents binding of SH2 domains without abrogating kinase activity and biological responses. Oncogene. 19 (2): 177-87.
  • Catalog:HG10762-NH
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks
    Images
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"