Pedido rápido

Human PCDH19 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

Hoja de datosReferencias específicasReseñasProductos relacionadosProtocolos
PCDH19Información de producto de clon de cDNA
Gene_bank_ref_id:NM_001105243.1
Tamaño de cDNA:3306
Descripción de cDNA:ORF Clone of Homo sapiens protocadherin 19 DNA.
Sinónimo de gen:EFMR, EIEE9, PCDH19
Especie:Human
Vector:pCMV3-C-His
Sitio de restricción:
Secuencia de etiquetas:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descripción de la secuencia:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"