Pedido rápido

Mouse TIMD4 / TIM4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
TIMD4cDNA Clone Product Information
Gene Bank Ref.ID:NM_178759.4
cDNA Size:1032
cDNA Description:ORF Clone of Mus musculus T-cell immunoglobulin and mucin domain containing 4 DNA.
Gene Synonym:Tim4, TIM-4, B430010N18Rik, Timd4
Restriction Site:
Sequence Description:
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-Myc Vector Information
Vector Name pCMV3-C-Myc
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-Myc Physical Map

Schematic of pCMV3-C-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

A type I transmembrane protein called TIM4 (T-cell immunoglobulin- and mucin-domain-containing molecule; also known as TIMD4), which belongs to the immunoglobulin superfamily and TIM family. TIM4 is involved in regulating T-cell proliferation and lymphotoxin signaling. It is a ligand for HAVCR1/TIMD1. Recent reports indicate that dendritic cell (DC)-derived T-cell immunoglobulin and mucin domain molecule (TIM)-4, which is expressed on dendritic cells and macrophages, plays an important role in the initiation of T(H)2 polarization. TIM4 bound apoptotic cells by recognizing phosphatidylserine via its immunoglobulin domain. The expression of TIM4 in fibroblasts enhanced their ability to engulf apoptotic cells. TIM4 is phosphatidylserine receptor for the engulfment of apoptotic cells, and may also be involved in intercellular signalling in which exosomes are involved. Modulation of TIM4 production in dendritic cells (DCs) represents a novel therapeutic approach for the treatment of peanut allergy. The interaction of TIM1/TIM4 played a critical role in sustaining the polarization status of Th2 cells in allergic rhinitis (AR) patients. Cross-linking FcgammaRI by antigen/IgG complexes increased the production of TIM4 by dendritic cells via upregulating tumor necrosis factor-alpha in DCs. Specific immunotherapy (SIT) suppresses the skewed Th2 responses via disrupting the interaction of TIM1/TIM4 in antigen-specific Th2 cells.

  • Miyanishi M, et al. (2007) Identification of Tim4 as a phosphatidylserine receptor. Nature. 450(7168): 435-9.
  • Feng BS, et al. (2008) Disruption of T-cell immunoglobulin and mucin domain molecule (TIM)-1/TIM4 interaction as a therapeutic strategy in a dendritic cell-induced peanut allergy model. J Allergy Clin Immunol. 122(1): 55-61.
  • Cai PC, et al. (2009) Association of TIM4 promoter polymorphism -1419GA with childhood asthma in a Chinese Han population. Tissue Antigens. 74(1): 11-6.
  • Zhao CQ, et al. (2010) Specific immunotherapy suppresses Th2 responses via modulating TIM1/TIM4 interaction on dendritic cells. Allergy. 65(8): 986-95.
  • Catalog:MG50388-CM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks