FTS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag

Price:
Size:
Number:

FTS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
879 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence (Nucleotide may contain silent mutation without changing amino acid sequence)
Description
Full length Clone DNA of Homo sapiens AKT interacting protein.
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Tag Sequence
GFPSpark Tag Sequence: GTGAGCAAGGGC……GAGCTGTACAAG
Sequencing Primers
pLen-F(CTCGTTTAGTGAACCGTCAGAATT), pLen-R(GAACCGGAACCCTTAAACATGT)
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Storage & Shipping
Shipping
Each tube contains 10μg lyophilized plasmid
Storage
The lyophilized plasmid can be stored at room temperature for three months

FTS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag: Alternative Names

FT1 cDNA ORF Clone, Human; FTS cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait