Pedido rápido

Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación)

Hoja de datosReseñasProductos relacionadosProtocolos
Human F10 Información de producto de clon de cDNA
Gene_bank_ref_id:NM_000504.3
Tamaño de cDNA:1461bp
Descripción de cDNA:Full length Clone DNA of Homo sapiens coagulation factor X.
Sinónimo de gen:F10, FX, FXA
Especie:Human
Vector:pCMV/hygro
Plasmid:pCMV-F10
Sitio de restricción:HindIII + XbaI (5.5kb + 1.46kb)
Secuencia de etiquetas:
Descripción de la secuencia:Identical with the Gene Bank Ref. ID sequence except for the point mutation: 792 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Almacenamiento:The lyophilized plasmid can be stored at room temperature for three months.
Human F10 Gene Plasmid Map
Human F10 / FX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación) on other vectors
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-GFPSpark EtiquetaHG11076-ACG$225
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-OFPSpark EtiquetaHG11076-ACR$225
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), N-GFPSpark EtiquetaHG11076-ANG$225
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), N-OFPSpark EtiquetaHG11076-ANR$225
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-Flag EtiquetaHG11076-CF$195
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-His EtiquetaHG11076-CH$195
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-Myc EtiquetaHG11076-CM$195
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), C-HA EtiquetaHG11076-CY$195
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(Vector de expresión)HG11076-G$75
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación)HG11076-G-N$195
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), N-Flag EtiquetaHG11076-NF$195
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), N-His EtiquetaHG11076-NH$195
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), N-Myc EtiquetaHG11076-NM$195
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación), N-HA EtiquetaHG11076-NY$195
Humano Coagulation Factor X/F10 clonación del ADN o clonación génica(vector de clonación)HG11076-UT$195
 Más información sobre los vectores de expresión
Product nameProduct name
Fondo

Coagulation factor X, also known as FX, F10, Eponym Stuart-Prower factor, and thrombokinase, is an enzyme of the coagulation cascade. It is one of the vitamin K-dependent serine proteases, and plays a crucial role in the coagulation cascade and blood clotting, as the first enzyme in the common pathway of thrombus formation. Factor X deficiency is one of the rarest of the inherited coagulation disorders. FX deficiency among the most severe of the rare coagulation defects, typically including hemarthroses, hematomas, and umbilical cord, gastrointestinal, and central nervous system bleeding. Factor X is synthesized in the liver as a mature heterodimer formed from a single-chain precursor, and vitamin K is essential for its synthesis. Factor X is activated into factor Xa (FXa) by both factor IX (with its cofactor, factor VIII in a complex known as intrinsic Xase) and factor VII (with its cofactor, tissue factor in a complex known as extrinsic Xase) through cleaving the activation propeptide. As the first member of the final common pathway or thrombin pathway, FXa converts prothrombin to thrombin in the presence of factor Va, Ca2+, and phospholipid during blood clotting and cleaves prothrombin in two places (an arg-thr and then an arg-ile bond). This process is optimized when factor Xa is complexed with activated cofactor V in the prothrombinase complex. Inborn deficiency of factor X is very uncommon, and may present with epistaxis (nose bleeds), hemarthrosis (bleeding into joints) and gastrointestinal blood loss. Apart from congenital deficiency, low factor X levels may occur occasionally in a number of disease states. Furhermore, factor X deficiency may be seen in amyloidosis, where factor X is adsorbed to the amyloid fibrils in the vasculature.

Referencias
  • Rosen ED. (2002) Gene targeting in hemostasis. Factor X. Front Biosci. 7: d1915-25.
  • Uprichard J, et al. (2002) Factor X deficiency. Blood Rev. 16(2): 97-110.
  • Borensztajn K, et al. (2008) Factor Xa: at the crossroads between coagulation and signaling in physiology and disease. Trends Mol Med. 14(10): 429-40.
  • Menegatti M, et al. (2009) Factor X deficiency. Semin Thromb Hemost. 35(4): 407-15.
  • Size / Price
    Catálogo: HG11076-G-N
    Precio de lista: 
    Precio:      (You Save: )
    Tamaño:
    Cantidad:+-
    DisponibilidadIn Stock
    Bulk Discount RequiryAñadir a carro
    Contact Us
    Imágenes
    • Human F10 / FX Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"