HIGD1A cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

HIGD1A cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
282 bp
Description
Full length Clone DNA of Human HIG1 hypoxia inducible domain family, member 1A.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

HIGD1A cDNA ORF Clone, Human, untagged: Alternative Names

HIG1 cDNA ORF Clone, Human; RCF1a cDNA ORF Clone, Human

HIGD1A Background Information

Full Name
HIG1 hypoxia inducible domain family, member 1A

HIGD1A cDNA ORF Clone, Canine, Related Products

Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait