After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

pCMV3-C-Myc Negative Control Vector (C-terminal Myc-tagged)

Hoja de datosReseñasProductos relacionadosProtocolos
  • Negative control for the pCMV3-C-Myc clone.
  • Vector sequence is the same as pCMV3-C-Myc, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-C-Myc-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-C-Myc-NCV
 Vector Size

6019bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag Myc
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-C-Myc-NCV (Negative Control Vector) Multiple Cloning Sites

Size / Price
Catálogo: CV014
Precio de lista: 
Precio:      (You Save: )
Cantidad:+-
Disponibilidad5 Business days
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      Artículos vistos recientemente
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"