After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

pCMV3-SP-N-HA Negative Control Vector (N-terminal HA-tagged)

Hoja de datosReseñasProductos relacionadosProtocolos
  • Negative control for the pCMV3-SP-N-HA clone.
  • Vector sequence is the same as pCMV3-SP-N-HA, but multiple cloning sites are removed.
  • Designed for mammalian expression, stable or transient.
  • Hygromycin resistance gene for selection of stable cell lines.
 
pCMV3-SP-N-HA-NCV (Negative Control Vector) Physical Map
 
Vector Sequence
Download     
 
Description
 
 Vector Name pCMV3-SP-N-HA-NCV
 Vector Size

6061bp

 Vector Type Mammalian Expression Vector
 Expression Method Constitutive, Stable / Transient
 Promoter CMV
 Antibiotic Resistance Kanamycin
 Selection In Mammalian Cells Hygromycin
 Protein Tag HA
 Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
 
Schematic of pCMV3-SP-N-HA-NCV (Negative Control Vector) Multiple Cloning Sites

Size / Price
Catálogo: CV021
Precio de lista: 
Precio:      (You Save: )
Cantidad:+-
Disponibilidad5 Business days
Bulk Discount RequiryAñadir a carro
Contact Us
Imágenes
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Nota: Todos los productos son "PARA SU USO ÚNICAMENTE EN INVESTIGACIÓN Y NO INDICADOS PARA SU USO DIAGNÓSTICO O TERAPÉUTICO"